Consider the following Sequence of a Dna Double Helix.

3- CAAATACAACTGGGTGGTTCCCACAATTAGAGG G-5

5-GTTTATGTTGACCCACCAAGGGTGTTAATCTCCC-3

A) Transcription is the process of production of RNA molecule from DNA sequence of a gene.

Out of two DNA strands, one strand acts as the template strand that runs in a 3′ to 5′ direction and is used for synthesis of a complementary RNA transcript. Other strand acts as the coding strand runs in 5′ to 3′ direction and is same as RNA transcript but it has uracil (U) bases instead of thymine (T) bases.

5′ to 3′ is coding strand and mRNA sequence is same but instead of thymine, uracil is present.

Therefore, mRNA sequence resulting from transcription is:

5′-GUUUAUGUUGACCCACCAAGGGUGUUAAUCUCC-3′

B) The amino acid sequence that this gene codes for is:

A Codon is three nucleotide sequence that codes for particular amino acid. Thus, if codon specifies stop codon which are UAA, UAG, and UGA then translation stops.

The start codon is AUG from where amino acid is synthesized and stop codon marks the end of translation.

Start codon marks the site at which translation into protein sequence begins. It is the first codon of a messenger RNA (mRNA) transcript which is translated by a ribosome. Stop codon is defined as codon that marks the end of translation.

Therefore, amino acid sequence is:

5′- Met-Leu-Thr-His-Gln-Gly-Cys-STOP

The post Consider the following sequence of a DNA double helix. appeared first on Questions House.