Lately, I've become enamored of RESTful web microframeworks written in Java, such as:Vert.x http://Vertx.io (sponsored by Eclipse) Spark http://Sparkjava.com Jooby http:/… Read More

I have found a number of sizable palindromes in Mycobacterium leprae Br4923. I report two here. The larger one is 74 bases long:GGTGCTTGTTTTGCAATCTCGACCATTACCTGGCCTTAAGGCCAGGTAATGGTCGAGATTGC… Read More

The Media Is an Arm of the Ruling Class of This Country (huffingtonpost.com).You're being fed information from just a handful of companies. See illustration below.Click to enrage.Modern muss… Read More

The False Promise of DNA Testing (theatlantic.com). "One recent study asked participants to shake hands with a partner for two minutes and then hold a knife; when the DNA on the knives was… Read More

Do I Really Need to Worry About Hillary’s Emails? Yes. She Will Be Indicted. (informedvote2016.wordpress.com). This is the single most comprehensive explainer you're likely to read on… Read More

New Study Predicts an Intolerably Hot World (takepart.com). Stake your claim to an Arctic corn farm today!Global cancer deaths rose by 260,000 during the last economic crisis (dailymail.co.u… Read More

Complex life a billion years earlier than thought? (phys.org). Well-preserved multicellular structures dating to 1.5 billion years ago have been found in China. The question is: What are the… Read More

Steal these news links for your social media timeline. Reuse as you wish.The Unnecessariat (morecrows.wordpress.com). This piece? Whoa. Hits you like a damn brick upside the head. A quick ex… Read More

This was the week the impossible happened: GOP's "stop Trump" squad (Cruz+Fiorina, Kasich+pizza) dropped out, clearing the runway for Donald Trump, who is now the only candidate actively run… Read More

Readers: Please feel free to share these links in your social media timelines. Reuse this material! I curate this stuff so you don't have to! What Would Happen If We Just Gave People Money?… Read More

It's not just Prince: Musicians die young (WaPo). Check out this graph from the story: "Across the seven decades studied, popular musicians’ lifespans were up to 25 years shorter tha… Read More

What It’s Like to ‘Wake Up’ From Autism After Magnetic Stimulation (nymag.com). Bookmark this. Savor it. Show it to friends.Why Voters Will Stay Angry (bloomberg.com). A st… Read More

Hillary Clinton’s Support Among Nonwhite Voters Has Collapsed (HufPo). "On February 27th, Hillary Clinton led Bernie Sanders among African-American voters by 52 points. By March 26th… Read More

Cat Forms Emotional Bond with Human (thedailymash.co.uk).Female Computer Programmers Make $0.72 For Every Dollar Made By Males: Glassdoor (glassdoor.com). I don't know how helpful this study… Read More

Mass Shootings Are Contagious (scientificamerican.com). It turns out rampages do not turn up randomly; an outbreak of gun violence tends to trigger further outbreaks. The paper (free online)… Read More

27 Large, Profitable Companies Paid No Taxes Last Year (usatoday.com). This needs to end. But it never will if people keep voting for corporate-lobbied incumbents and GOP oligarchy shills… Read More

Trump, the unifier. Why can't the leaders of the Republican Party see that I am bringing in new voters by the millions-we are creating a larger, stronger party! — Donald J. Trump (@re… Read More

Syria: Another Pipeline War (ecowatch.com). The nephew of JFK has (in this article) written an impressive, detailed, scathing history of what we in the West call "The Middle East," tracin… Read More

Most voters are ready for a political revolution to redistribute wealth (americablog.com). Even Tea Party supporters agree, which is amazing.  “It’s the corruption, stupid… Read More

What is money? It turns out economists don't have a terribly rigorous definition for it; there's no consensus definition of money beyond the old tripartate "medium of exchange," "medium of a… Read More

The Ban on Cash Is Coming. Soon. (sovereignman.com). There've been a ton of stories lately about this. The meta-theme is: As negative interest rates overtake the bond market (and the money m… Read More

Addendum: My father died a horrible death of lung cancer. There's plenty of cancer in my family and I expect to die of it myself someday. But I'm still against a "cancer moonshot." Recently… Read More

Yukako Fukushima inspects a prosthetic pinkie. Some 45% of Yakuza members have self-amputated a finger in atonement for misdeeds.The Woman Who Makes Prosthetic Pinkies for Ex-Yakuza Members… Read More

I woke up today in one of those perilous half-dreamy states where you think you may have stumbled onto a Surprisingly Great Idea (an idea which might, on reflection, turn out to be shit, lik… Read More

Every week, on my Twitter timeline, I tweet a lot of disturbing left-wing crap mind-twisting news stories (according to Twitter Analytics, I made a million impressions this week, all of the… Read More