Five Gene loci appear to define the morphologic shape of a Human face. According to Liu et al. in PLOS Genetics 2012|8|9|e1002932, they are located in and around the PRDM16 gene on Chromosome 1, the chromosome 2 gene PAX3, TP63 on chromosome 3, C5orf50 on chromosome 5, and the COL17A1 gene on chromosome 10. These findings came from a genome-wide association study (GWAS) performed by members of the International Visible Trait Genetics, or VisiGen, Consortium where several Affymetrix and/or Illumina arrays were used to identify these loci.
Facial features, in this case were studied in close to 10,000 volunteering Europeans, range from nose width and height to the distance between a person's eyes. The Consortium studied volunteers of European ancestry living in the Netherlands, Australia, Germany, Canada, and the United Kingdom. The group used 3D MRI based phenotyping together with autosomal single-nucleotide-polymorphism (SNP) analysis to extract Facial landmarks and to find association for the 48 identified facial phenotypes. They were able to identify common DNA variants within the five genetic loci which led the researchers to conclude that these genes are associated with normal facial shape phenotypes in individuals of European ancestry.
We can notice differences in facial shape in other individuals when we go out for dinner, look around in a bar, attend social meetings or walk around in a park or the streets of a city. Variations of facial shapes are one of the most noticeable phenotype in humans. Clearly the Facial Morphology in humans is under genetic regulation. For example, monozygotic twins look more alike than dizygotic twins or other siblings or even unrelated individuals. This indicates that Human Facial Morphology has a strong genetic component. This study identified the genes that are essential for the development of the craniofacial morphology in humans and provided novel links between common DNA variants and normal variation in human facial morphology and confirmed known ones as well. However, more genes that participate in the regulation of these five genes may need to be identified to allow for the prediction of a facial shape from DNA data to be useful for future forensic applications. Already scientists are able to predict certain eye and hair colors with high accuracies using DNA analysis. Table 1 shows the identified genes, their chromosome location as well as the SNPs of the identified genes.
Table 1: The five identified genes are listed as well as the sequences of the SNPs involved.
Gene | Chromosome | SNP | Sequence |
PRDM16 | 1p36.23-p33 | rs4648379 | TCTGTGGGGCCCTTTGCAACCTCCCT[C/T]ATGCATGAGCAATTCAGGGGTTTGA |
PAX3 | 2q35 | rs974448 | ACAAATTTTAAAAATTAATTTAAAAA[C/T]TCTGTTCTGTTTAACACTAATAATC |
TP63 | 3q28 | rs17447439 | CCAGGTGCTCATTTGATGATAGCAGC[A/G]TGAAGCTCTTCCCATTCTGCACCGT |
C5orf50 | 5q35.1 | rs6555969 | TCCAATCCTCTCATCTGTCCCTCTAA[C/T]GGGCTCCGACAGATCACTCCACAGT |
COL17A1 | 10q24.3 | rs805722 | CATACCTTTGGGTCCTGGTGGTCCCA[C/T]TGGTCCTTTGTCACCTAAAAAGGAA |
Source: Liu et al., PLOS September 2012; NCBI SNP Database: http://www.ncbi.nlm.nih.gov/snp?term=rs805722
This post first appeared on BIO-SYNTHESIS - Custom Antibody Custom Peptide Syn, please read the originial post: here